THE HOUSE that GOD BUILT

VOLUME 1 – THE CELL

BY:  ROBERT D. TORANGO

STUDY SIX

THE CELL – DNA – THE BOOK OF LIFE

Gen 2:20-23…20] And Adam gave names to all cattle, and to the fowl of the air, and to every beast of the field; but for Adam there was not found an help meet for him. 21] And the LORD God caused a deep sleep to fall upon Adam, and he slept: and he took one of his ribs, and closed up the flesh instead thereof; 22] And the rib, which the LORD God had taken from man, made he a woman, and brought her unto the man. 23] And Adam said, This is now bone of my bones, and flesh of my flesh: she shall be called Woman, because she was taken out of Man. (KJV)

Luke 1:30-37…30] And the angel said unto her, Fear not, Mary: for thou hast found favor with God. 31] And, behold, thou shalt conceive in thy womb, and bring forth a son, and shalt call his name JESUS. 32] He shall be great, and shall be called the Son of the Highest: and the Lord God shall give unto him the throne of his father David: 33] And he shall reign over the house of Jacob for ever; and of his kingdom there shall be no end. 34] Then said Mary unto the angel, How shall this be, seeing I know not a man? 35] And the angel answered and said unto her, The Holy Ghost shall come upon thee, and the power of the Highest shall overshadow thee: therefore also that holy thing which shall be born of thee shall be called the Son of God. 36] And, behold, thy cousin Elisabeth, she hath also conceived a son in her old age: and this is the sixth month with her, who was called barren. 37] For with God nothing shall be impossible. (KJV)

As we have seen in our previous studies, DNA is made up of 2 sides of genetic material, which is joined in the middle to form a ladder of instructions, which is literally a book of life. The most amazing thing about this subject is how God, who is the original creator of this genetic molecule, hid this structure from the eyes of mankind until a set and appointed time of unveiling, which has been unveiled in this present 20th century. It must be noted that this is the same century that God also has destined to unveil to His elect the revelation of His salvation for all men and the third and final Feast, which is the Feast Of Tabernacles, which means that God is revealing Himself in man. I have been stating for many years now that God is in every man, sinner and saint alike. He does not come from outer space to dwell in us at the point of a confession, but He arises out of our inner heart to meet with us and have a relationship with us at that confession.

It is this revelation that is a direct fulfillment of the scripture that quotes Jesus in Matthew:

Matt 12:40 For as Jonas was three days and three nights in the whale’s belly; so shall the Son of man be three days and three nights in the heart of the earth. (KJV)

The two significant words in this scripture, “belly” and “heart,” coincide with one another. The Strong’s definition for belly is as follows:

2836 koilia (koy-lee’-ah); from koilos (“hollow”); a cavity, i.e. (especially) the abdomen; by implication, the matrix; figuratively, the heart: KJV– belly, womb.

Notice that the womb is the actual place spoken of, not the abdomen. The womb is the place where life takes form, when the one side of the ladder of DNA which is found in the sperm is introduced and joined to the other side of the DNA ladder in the egg, and it is here, in the womb, where life arises and a new creature is formed. DNA is at the root of our existence and God is the one that made it so. It is this joining, or melting together of our single strands of genetic material that most fulfills the scriptural language in the born again experience, when the old and the new come together to form a new thing. Heaven and earth, natural and spiritual, light and darkness, death and life are all examples of opposites coming together to form a union that cancels out the negatives and creates a new heaven and a new earth, for the old things have passed away, (taken on a new expression) and Behold, all things are become new. How glorious and mysterious are the workings of our Lord! This union is both mystical and physical. The natural takes on a garment of spiritual and in the language of 2 Corinthians the 5th chapter, we are clothed upon, with this house from heaven. It is important that there is not an expectation of unclothing, but one of “putting on,” not a shedding, but an act of overtaking, overcoming, a swallowing up of the lesser and weaker vessel by that which is, by reason of its design, a vessel of glory and light.

We are made up of a book of generations. Our existing self is a compilation of all generations that have gone before us. This is true in the natural and it is true in the spirit. Just as the fulness of the Father embodies us, the fullness of the ages embodies us. We are the world, and the world is us. We are physically joined to the whole living world by reason of our DNA, which is found in all living things, plant life, animal life, bacterial life, all life has this same structure at it’s roots. This is an awesome witness to the mystery of creation, because if nothing else, DNA must be seen as the “finger print of God,” authenticating Him as the Creator of all things. What makes each species different and each class of creature so diverse, is what kind of instructions are found in the “book of life” for each class. The structure is the same, a 2 stranded ladder, but according to the complexity of the instructions the creatures differ. The more complex the organism, the more intelligent and God-like it is. Man is most intelligent and capable of all God’s creatures, and it is upon this creature that Genesis records God’s image and likeness was to be imprinted. This is not to say, however, that man is the most God-like of all the creatures, since man can also be brought down to the level of the beast and the snake, and be cunning and cruel, with the intelligence to seek revenge and to murder for the sake of murder alone, which are extreme aberrations in the other kingdoms of creatures.

It is this instinctual behavior, which is passed on genetically, not something learned but something, which is acted out if not held in check by laws and societal mores. More and more study is being done on the role that DNA plays in predisposing us to certain temperaments and personalities, and the signs are becoming more and more numerous that we are indeed influenced much more than previously thought by genetic instructions, not just in the shape and form of our body, but also in the shape and form of our nature. This tends to give credence to the idea of “bad seed” being produced by a mutation of genetic material, something that has been isolated to physical abnormalities, but now it is being studied how much DNA mutations can create abnormalities in one’s personality and behavior. To be sure, we know that Peter mentions “brute beasts,” which are called “spots and blemishes” and he terms them “wells without water.” They were, literally and figuratively, mutations of the faith, coming amongst the elect and seeking to devour them with greed and lust.

Mutations occur when the gene sequence of the DNA is changed and the original instructions cannot be followed as intended. Every error in the holiest of all, the nucleolus of the cell, will eventually have a manifestation in the body of the organism. This is why the DNA is such a marvel, because of the uniformity it must keep between trillions of cells. The instructions must be kept sacred and undefiled and unchanged, or else the body will suffer terribly and eventually die. We see the sad and tragic results of DNA mutations all around us in the natural, with disfigurements and deformities abounding in our present age. Much is being discovered to be a result of our pollution of the air and earth, with chemicals showing up in food, and water. Many things can cause DNA mutation, such as too much sunlight on the skin, which can cause skin cancer, toxins and chemicals that are ingested which can cause the DNA to not be reproduced normally, changing the instructions of the “book” and causing the cell to produce abnormally, which can lead to various diseases and physical weaknesses. Cancer is rampant, and no definitive cure is found for it yet, except for a horrible treatment of radiation and chemotherapy, which hopes to kill the cancer before they kill the patient, and except for a miracle from God, or the stimulation and strengthening of the immune system to fight the cancer, the treatments are for the most part unsuccessful. Cancer is defined as cells that have lost their original identity, and have lost their sense of self. Cancerous cells have lost their generational identity, which keeps healthy cells human, and instills in them a sense of being a part of the whole, but when a healthy cell is mutated into a cancerous cell, it is living an individual existence, and will invade the host organism and draw off of the host’s resources as long as it can, eventually growing to a point that it metastasizes, and the organism can no longer stay healthy. If left alone, the organism will be totally overcome by the cancer.

Mutations occur in the spirit also. Whenever God’s people leave the original instructions for serving God and living in His life, they will mutate and become antichrist. The instructions that I am talking about is not limited only to the scriptures, which have been found to have both life and death in them, according to the interpretation. In other words, if one was to read the bible according to one’s understanding, the scriptures will lead that person only to an outward, religious knowledge of God, dwelling in ordinances and rituals and traditions of the flesh, and knowing God only through types and shadows. The scriptures only TELL about God, they do not GIVE God. This is the reason for so many different beliefs and denominational structures throughout the world of Christianity. The scriptures themselves are subject to mutation and they must be read and dealt with according to these mutations, which are most readily recognized in the King James Version of the bible, which has become the standard of most Christians. Mutation leads to further mutation, until the mutating error is dealt with and removed. We that are walking in present truth have all walked in error until God started to bring us to our right minds, correcting our walk in Him according to our lower nature and allowing us to experience and be changed into the higher nature of Him that birthed us, removing from us the sentence of death and the agreement that we had with hell, and reintroducing us to our “new” covenant, which is only new by reason of our mutation.

One of the most relevant scriptures to this part of the study lies in the book of 2 Kings and 2 Chronicles. Josiah is the young king of Judah, beginning his reign as king at the tender age of 8. In his 18th year, Josiah endeavors to send Shaphan, the scribe, to The House Of The Lord, to have the monies that have been taken in by the priests delivered into the hands of the carpenters and masons to buy materials to rebuild the House of God. While in the Temple, Hilkiah, the high priest, finds the original book of the law written by Moses, buried under the money kept by the priests. Isn’t it amazing that the very book that kept order in the House of God was buried by one of the most mutating substances in the world of religion, money. Let us read.

2 Chr 34:14-21…14] And when they brought out the money that was brought into the house of the LORD, Hilkiah the priest found a book of the law of the LORD given by Moses. 15] And Hilkiah answered and said to Shaphan the scribe, I have found the book of the law in the house of the LORD. And Hilkiah delivered the book to Shaphan. 16] And Shaphan carried the book to the king, and brought the king word back again, saying, All that was committed to thy servants, they do it. 17] And they have gathered together the money that was found in the house of the LORD, and have delivered it into the hand of the overseers, and to the hand of the workmen. 18] Then Shaphan the scribe told the king, saying, Hilkiah the priest hath given me a book. And Shaphan read it before the king. 19] And it came to pass, when the king had heard the words of the law, that he rent his clothes. 20] And the king commanded Hilkiah, and Ahikam the son of Shaphan, and Abdon the son of Micah, and Shaphan the scribe, and Asaiah a servant of the king’s, saying, 21] Go, inquire of the LORD for me, and for them that are left in Israel and in Judah, concerning the words of the book that is found: for great is the wrath of the LORD that is poured out upon us, because our fathers have not kept the word of the LORD, to do after all that is written in this book. (KJV)

Is this not where we find ourselves today? We have spent the whole night fishing, and catching nothing, but now we are receiving a fresh word from the Master, go out again, but this time cast the net on the right side of the boat! Judah had mutated in their worship and walk in God, because they did not have the original set of instructions that would allow them to become the heirs of God’s blessings. There is a set of instructions, principles, articles of faith, that we are receiving today. Dear ones, we are being reintroduced to our former state of being, to that form and likeness that we are destined to exist in, and we also have rent our clothes when we realized how far off we have been. How can anyone truly born of the spirit of God not embrace the message of salvation to all men? How can anyone that truly has been regenerated by the Holy Spirit not see Him in every man and know that He dwells within His house not made with hands? The only way that the religious prisoners of the Babylonian church cannot see this and embrace it is because they have mutated into that false image, and have received the mark of the spirit of antichrist. Does this mean they are hopelessly lost, unable to ever know God? Of course not! However, they will have to go through a beheading, a losing of their mutated consciousness, and have an ascension of His mind and will for their life.

Haven’t we all had our heads chopped off that have been walking this Way? Some of the churches I have preached in have gone through such a slaying of their ideas and imaginations and dogmas that the church looked like a bowling alley on a Friday night, with heads rolling down the aisles with every swoop of revelation. One thing is evident to those of us that have been involved in this new Walk, and that is that God will not share His throne with our carnal self. This Word will not spare and will not show any mercy to those mutations of our mind that constantly lead us opposite to the nature and character of God. When the Lord takes His throne, every dominion and power will fall and declare allegiance to Him. Every spirit of antichrist will be bound with unbreakable chains of reserved judgment and will bring hurt and destruction to our land no more! We are made free by the inworking of this mighty Book Of Life, the spiritual counterpart to our physical DNA, and God is redeeming us by the shedding of our blood, which represents our old life, and the reGENEration, and the reGENING of our whole man, body, soul and spirit.

So many today are growing weary of this Day. I have never heard so many people, particularly those that call themselves ministers of this Day, complaining about this Day. I have heard many say that “they cannot preach a Word that doesn’t work for them,” or, “I’m tired of not getting my needs met,” or, “this Word is too lonely, I need fellowship and my children need Sunday School and more kids to play with” and on and on. Have you heard this? Doesn’t it make God sound bad? I think all of these people need to get reconnected to why God brought them into this Word in the first place. It wasn’t to bless them, He brought them into this Word to make them a blessing. How do we become a blessing? We lose our heads. We get stripped of our man-life, we get castrated, losing our ability to reproduce after the flesh. This is the only way that you can be the blessing of God in the earth! If you are still doing only what you want to do, going where only you want to go, and preaching only what you want to preach, then you are a cancer in the Body of Christ and you must be dealt with. I have never been so shocked in all my life as to hear of so many that want a man to rule over them. Many of the so-called Life churches are trying to minister what they call the Kingdom message, which in itself is fast becoming a term for “The Mutant Message From Hell,” and trying to confine this Word and revelation into a box of rules of conduct and organization that come straight out of the Charismatic Manual For Successful Church Building. They are using formulas and principles of man-worship that will bring nothing but stagnation and death. It is a mutation of the precious Word of Life that many of our forefathers gave their lives to pass onto us unchanged and undefiled. These young, impetuous, immature preachers are hearing the Word of the Kingdom and mutating it to form it into an image that is more pleasing to their flesh. After all, who wants to go to all those preacher conventions driving an ordinary car and wearing an unspectacular suit, and have to tell everybody that asks that you have a small congregation. It makes me sick. I didn’t get dragged through all the hell-fire that I’ve been through all these years just to end back up preaching a new Word stuffed into the same religious bondage that I’ve so graciously been delivered from.

I have a word for all these young marketers, those that think us old heads have fumbled the ball and that need to bow down to their strategies and schemes to build this Word into a thriving, prosperous, megachurch. Go ahead. Build your buildings, change the Word however it suits you, demand titles to be placed in front of your names, subject your people to a government of religious bondage, form your fellowships of likeminded ministry that think this Word has failed them, become the counselors and sustainers of the complainers and backbiters, fill your coffers with bloody money, buy your popularity by selling your birthright, hide this pure truth under the covering of your empty and ambiguous message of Kingdom-Lite, a message that has no gender, and stands no ground, but kisses the lips of every church that has enough money to warrant it. Go ahead and do it. But know this one thing. It will all fall, in a moment, in an eclipse of your false light, God will not show the works of your hands any mercy, but will move in His determination to bring every throne and dominion under Him.

It is time for a reality check. This Word will not allow us to become proteges of Babylon. It will keep and sustain all who heed it’s call to the mountain. The one thing that seems to escape most people about this Word is that it is not a material Word. If you want to be a money-monger, better find another word. If you are looking for a ministry to be your career in life, better get another ministry. If you want to be popular and grandiose, better go the way of all the other celebrity preachers. But if you want God, in all of His pureness and substance, if you have a consuming desire to be His voice in the earth, if you are overcome by a love and adoration for Him, and if you are able to feel the hurt and need of creation, and want to bring an end to death and it’s effects on that creation, no matter where it takes you and no matter what it costs you, if you don’t care about who is for you, or who is against you, and if you can come to the understanding that none of this great Word involves YOU, bringing YOU to glory, giving YOU a crown, making YOU a king, giving YOU authority, giving YOU dominion, but if you can come to the realization that YOU are nothing, a mere vessel through which God can become all in all, then you may qualify to be one of the few, one of the chosen, that bear allegiance to no man, no church, no institution, no order, no government, no office, but their allegiance and duty is to one King, one Father, one Lord, one God, one Faith, one Covering, one Source.

These chosen vessels will not be found in the book of religious pedigree, for their lineage is not of this world. They are made up of every color, every culture, and every background. Their unity is not in race, or creed, or nationality, or statement of belief. They are unified by an invisible lineage of spirit that cannot be formulated and copied. A thread of destiny and purpose binds them together, and they only find fellowship in the presence of their Lord. Some of these vessels don’t speak to each other or see each other but maybe once or twice a year, if that, and yet they would give their lives for one another, and do so on a regular basis. Without any manmade structure of government these vessels are walking in a strength and peace that cannot be swayed. Their steps are ordered by their Lord and they are committed to Him, full or empty, rich or poor, in health or sickness, in the midst of thousands or a few, they are constantly learning of God’s ways and their mouth is filled with thanksgiving and praise. They serve a mighty God, a loving God, One that will never leave them nor forsake them. They are His for the taking, to lead into hell itself if necessary to minister a Word to the prisoners. They open not their mouth, no complaint passes their lips, they count all the wealth and glory of this world as dung, but to gain the pleasure of their Heavenly Father. They are not children, full of tantrums of discontent, but they are Sons of Thunder, Angels of Light, Messengers of Glad Tidings, Heirs of a Kingdom that they already know will be handed back to the Father when all is finished and done. They have no desire to be praised and glorified by men, but only one voice of praise will appease them, and for that Voice they will climb mountains and cross rivers and scale fortress walls to bring glory to that majestic Name. They are their Father’s children, born of an incorruptible seed, showing forth His attributes and character, dealing out mercy for vileness, peace for pain, forgiving their enemies and laying nothing to their charge. They can take no glory for any of these acts, for they have ceased to exist, having lost their life in Christ, they are now found only in Him. They have come to a place where, left to their own strength and ability, they are not able to preach anymore, going dumb when the Christ does not enable them to speak. Until Christ comes on the scene, they are stupid and ignorant, not able to even tell you what they believe or preach. But when Christ does appear, they become orators supreme, mouth pieces of the Voice of Many Waters, trumpets of God whose sounding forth brings hell to it’s knees and jubilee to all in hell’s debt. When Christ appears they are the very expression of God in the earth, His jewels and crystals, showering the earth with their rays of light, shining forth unto them that sit in the regions of the shadows of death.

DNA is meant to keep the order of life in the house. There is an order of life, an invisible law, written into each one of our cells, that overrides that cell’s individual existence and causes it to cease to live for itself. We also, as members in particular of this great House that God has built, must abide by a law of Life, an innate knowledge and understanding that we must be connected to the Vine to have life and we must live and walk in God as a Corporate Man, joined by a generational kinship, that tells us that we are of the same form and fashion and we are in the highest and truest sense of the word, Kinsman. Let us read a scripture that illustrates this as spoken to Israel.

Ezek 43:10-12…10] Thou son of man, shew the house to the house of Israel, that they may be ashamed of their iniquities: and let them measure the pattern. 11] And if they be ashamed of all that they have done, shew them the form of the house, and the fashion thereof, and the goings out thereof, and the comings in thereof, and all the forms thereof, and all the ordinances thereof, and all the forms thereof, and all the laws thereof: and write it in their sight, that they may keep the whole form thereof, and all the ordinances thereof, and do them. 12] This is the law of the house; Upon the top of the mountain the whole limit thereof round about shall be most holy. Behold, this is the law of the house. (KJV)

Just as Josiah found a book of the law in the temple that shamed him into calling the people out to assemble to hear the word of the book, even so, I pray that we will be able to shame one another to righteousness, as we see the order of things in our midst as prescribed by our natural mind. The order of things as dictated by the lusts and greed of men brings an imbalance to the Body of Christ. The ministry get fat and full, but the people of the Lord grow weak and sickly by working for that which is not bread, and filling pockets with holes in them. The cisterns are cracked and leaking, and each one is always looking for something to fill their need, whether it is a greater gift of knowledge, or a greater gift of miracles, or a greater gift of preaching, they are always empty when the gift is over, not having anything accomplished and touched except the realm of their senses. This Word of the House must be taught so that we can start to minister to the root of our problems, not operating in the realm of goosebumps, but ministering out of the heart of the Father. We are suffering from generational sins that must be dealt with by a generational Word, that goes back farther than the sin, and has the “exousia,” or the authority, to bring an end to the lineage of the flesh. Saviors must come forth from Zion with the power to cut off the house of flesh, or sinful thinking, which is nothing more than thinking that obtains it’s thoughts from a lower realm.

We have 2 lineages, with one leading back to a garden, and the other leading much further back into the heart of God. In our being, which is made up of a body, soul, and spirit, we have the 2 lineages abiding, one from Adam, the other from Christ. Our spirit is the lineage to the heart of the Father, and our soul and body involves the lineage to the garden. For the vast majority of our life, we have been more familiar and knowledgeable of the life of the Adamic lineage and less familiar and aware of the Life that comes from the Christ lineage. God’s plan is not for us to cut out and discard the lineage of Adam, leaving only the generational lineage of Christ, but rather to swallow up the Adamic lineage into the lineage of Christ, creating a whole, new man, a new thing that has never been before. Our former state of being, in the Father, was not the goal or intent of God, hence, the mixing of spirit, soul and body. This union of earth and heaven is the pattern that we find in the biological process of conception and birth. Let us delve into just what happens in order to bring a new human into the world.

In each human body there are trillions of cells that must be reproduced to replace the old, dying cells. Remember, the DNA ladder is actually 2 strands, or ribs, joined together at the middle of the rungs of the ladder. As the cell starts to go through “mitosis,” which is the process by which cells multiply, the cell goes through many changes, as it gives birth to another, duplicate cell. The daughter cell must have the same amount of genetic information as the parent cell, so the DNA must double itself before it divides. This process involves an “unzipping” of the ladder, exactly like the zipper we use in our clothing, in which the rungs start to separate at one end of the ladder and continues to divide and separate until the whole ladder is “unzipped.” As the ribs of the ladder separate from one another, the single strands start to reproduce themselves, building themselves a matching rib. We explained in our previous study that this is accomplished by the template by which the ladder is built and the code that is programmed within that template. The ladder is built with 4 bases, Adenine, Thymine, Guanine, and Cytosine. As the ladder separates and becomes singe stranded it is made up of a template of bases, such as the following sentence:

ATTGGCTAGCCCAATGGCTAG

When the single rib reproduces itself, it just builds the matching code of bases to fit the template, which is:

TAACCGATCGGGTTACCGATC

From which you would have a double strand ladder.

As you can see, the template, or pattern, of the old strand of DNA makes it possible to create a duplicate strand that is an exact copy of the original strand, creating a new, twin double strand of genetic instructions. This is the reason our cells can multiply, forming kind after kind, and replacing the old, dead cells with new, carbon copy, live cells. It is indeed a design that only a Master Creator could come up with, and is the design that we see in all things relating to heaven and earth. The book of Hebrews tells us that the earthly tabernacle and the earthly furniture of the tabernacle, and even the earthly priesthood and sacrifices were but shadows cast upon the earth by those heavenly things that they represented.

Heb 8:1-5…1] Now of the things which we have spoken this is the sum: We have such an high priest, who is set on the right hand of the throne of the Majesty in the heavens; 2] A minister of the sanctuary, and of the true tabernacle, which the Lord pitched, and not man. 3] For every high priest is ordained to offer gifts and sacrifices: wherefore it is of necessity that this man have somewhat also to offer. 4] For if he were on earth, he should not be a priest, seeing that there are priests that offer gifts according to the law: 5] Who serve unto the example and shadow of heavenly things, as Moses was admonished of God when he was about to make the tabernacle: for, See, saith he, that thou make all things according to the pattern shewed to thee in the mount. (KJV)

The tabernacle pitched in the wilderness was built by matching it up as an opposite of the template in the heavens, the pattern that Moses is told to be sure to follow in building the tent. Jesus let us know of the template relationship between heaven and earth in the following scripture dealing with binding and loosening.

Matt 16:19… And I will give unto thee the keys of the kingdom of heaven: and whatsoever thou shalt bind on earth shall be bound in heaven: and whatsoever thou shalt loose on earth shall be loosed in heaven. (KJV)

As we look at the illustration provided on this page of the division and replication of the DNA molecule it may help to better understand the scripture that deals with the “New Heavens and the New Earth.

Rev 21:1-3…1] And I saw a new heaven and a new earth: for the first heaven and the first earth were passed away; and there was no more sea. 2] And I John saw the holy city, New Jerusalem, coming down from God out of heaven, prepared as a bride adorned for her husband. 3] And I heard a great voice out of heaven saying, Behold, the tabernacle of God is with men, and he will dwell with them, and they shall be his people, and God himself shall be with them, and be their God. (KJV)

Notice that the passing away of the first heaven and first earth matches up with the DNA illustration. The old strand is no longer together, but it is joined with a new strand, making it a new thing. The old is not annihilated, but is joined and matched with the new, swallowed up into the new formation. The earth that we live in now is not going to be annihilated and destroyed, it is going to be replenished and joined unto that New Jerusalem which is going to bring a cure to the curse that has been upon it. The heavens, or the atmosphere, is not going to be destroyed, but it is going to be joined and replenished by that heavenly kingdom which abides forever. Nothing is wasted, or left out, only swallowed up into the new by reason of this joining of the 2 opposites, making a NEW THING. The wolf and the lamb lie down together, the lion and the bullock feed in peace, the body, soul and spirit form a union of marriage with the Christ and they form a new compound of such wonder and grace that the angels hush their singing to gaze at this sight. A new creature is born, part earth, part heaven, part man, part God, part old, part new. What a wonder. A God-man, with the name of his Father upon his forehead and a scepter and a crown in his hand, sitting with his elder brother in their Father’s throne.

During the process of mitosis, the cell doubles its chromosome count, from 23 pairs to 46 pairs. Some very distinguishing changes start to happen throughout the cell as the DNA begins to divide and rebuild itself. The organelles in the outer court of the cell begin to dissolve and the cell grows to almost double its size. The nuclear membrane that used to divide the cell up into it’s three compartments starts to dissolve, which is a direct correlation to the events which happened when Jesus gave up the ghost at Calvary, as the scripture points out that the veil in the temple was rent from top to bottom, exposing the holiest of holies to the outside world. In fact, the whole event of the birth, life, death and resurrection of Jesus Christ runs parallel to the every day events that happen in our cells. God did not bring Jesus just to be the singular and individual Son of God, but the scriptures make it plain that He is our forerunner, our pattern Son, our elder brother, that He is the first of many to ascend. So it is, that when He was born of the virgin, Mary, He joined Himself with the rib of Adam, bringing to that rib a cure for the curse that was written therein, and has forever identified Himself with us, to deliver us from the dire consequences of the Adamic lineage and to bring peace to our divided house.

By adding Jesus to the earthly lineage of mankind, the Father performed the union necessary for heaven and earth to come together. The birth of Jesus had consequences that were both physical and spiritual. He could not just be our spiritual brother, He had to partake of all of our sufferings and weaknesses in order to deliver us. He had to become our template of redemption, incorporating into us a new strand of divine DNA, writing His laws upon the tables of our being, and giving us a lively hope, establishing in both earth and heaven an ongoing process of salvation and redemption, and ensuring us that this process of change would not stop when we laid our physical bodies down, but it would continue on through the ages to come, until the creature is delivered and set free from every vestige of the old law of sin and death. That law of sin and death has been planted in the earth to provide a match for God’s eternal grace and righteousness.

Paul gives a glorious expression to this marvelous truth in the book or Romans as he expounds on the connection between the two templates of law and grace. One is no good without the other, and he even goes on to say that grace could never be realized without the institution of the law first.

Rom 5:17-21…17] For if by one man’s offence death reigned by one; much more they which receive abundance of grace and of the gift of righteousness shall reign in life by one, Jesus Christ.) 18] Therefore as by the offence of one judgment came upon all men to condemnation; even so by the righteousness of one the free gift came upon all men unto justification of life. 19] For as by one man’s disobedience many were made sinners, so by the obedience of one shall many be made righteous. 20] Moreover the law entered, that the offence might abound. But where sin abounded, grace did much more abound: 21] That as sin hath reigned unto death, even so might grace reign through righteousness unto eternal life by Jesus Christ our Lord. (KJV)

As Hebrew the 15th chapter says, first there was the natural and then afterward the spiritual, the first man was earthy, the second man is the Lord from heaven. First the natural rib, Adam’s contribution to Eve, the mother of all living, and then the spiritual rib, the visitation of God upon the womb of Mary, the union of spirit and flesh, and the formation of the first God-man, Jesus Christ. Not that the natural rib of the law preceded the rib of grace, because Christ was crucified before the foundations of the world and was made our redeemer even before we needed to be redeemed, but the rib of the natural law of sin and death was the first to find manifestation in the earth, whereby we are now waiting on tiptoes to see the rib of God’s grace and salvation meet up with our rib of death and change it, from a vile, corruptible expression into that glorious, incorruptible expression that He is, an expression not in the heavens, but in the earth, Christ, appearing in His saints.

All of the Logos of God has not been manifested as of yet. There is some that has been reserved in the heavens until the times of restitution of all things. It is present, not a Word that is yet to be created, but it is looking for a people to manifest itself in, to complete the double stranded union of God and man. Just as the cell prepares to divide by tearing down its former state of being and going through a metamorphosis of change, we also go through our times of transition, where we lose our former glory and become unable to function for a period of time. In the next article we will see how Jesus lowered Himself, taking on the form and fashion of a lower existence, allowing Himself to be taken to a cross of shame and pain in order to pass on to us His relationship with the Father. He is now forming a Man in the earth, one that will match up to His image and likeness, as a die that has been cast in the heavens, He is now making the opposite and matching die in the earth, and when He is done, there will be an image produced which is made by the stamping and sealing of heaven and earth coming together, an icon of His nature and character in the form of a Man, one that will speak as His oracle, one that will walk His walk, talk His talk, and do His works. He cannot, and will not do it by Himself, He must be one with His brethren to perform the “greater works.”

The Feast is upon us. The marriage is at hand. The Bridegroom is here and it is time. Breathe His essence into your being and allow Him to rearrange your existence. There is a higher way, a better way, a way that no flesh can abide, but only those that are redeemed out of the earth, upon whom the ends of the world have come. Creation groans, heaven awaits. Is there a Man in the earth that will stand the test? Is there a generation that will be counted as His regeneration. Will we return back to our former state of being, and become once again the image of our Father? Yea, beholding as in a glass, the glory of the Lord, we will be changed into the same image, from glory to glory, even as by the Spirit of the Lord.

 

THE HOUSE that GOD BUILT, Volume 1, Study 6 [Robert D. Torango]          1

 

Pin It on Pinterest